kseniyayakimno kseniyayakimno

23-04-2018
English

contestada

One essential of the market mechanism is competition. True False

Respuesta :

Empoofcats Empoofcats

27-03-2020

Answer:

True

Hope this helps

Answer Link

05-08-2021

Answer:

true

Explanation:

Answer Link

Otras preguntas

tips para perder el miedo a un sismo o terremoto y planes de evacuacion como el triangulo de la vida y kits de emergencia

Which of the following examples would be classified as a dependent clause? A. whirling through the yellow-colored sky B. the mile-wide black tornado roared C.

what type of sentence is used to give a command

Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what happened when citric acid and and bicarbonate soda mixed together

How is the location of an electron described?

How many cm has a inch

Which best describes the climax of the Odyssey? A. Odysseus kisses the ground as his journey home comes to an end. B. Odysseus sees Telemachus for the fir

1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat