iashleywalter1481 iashleywalter1481
  • 23-03-2018
  • Biology
contestada

What are the areas of the body that can be used to obtain body temperature?

Relax

Respuesta :

claudettoterohil
claudettoterohil claudettoterohil
  • 25-03-2018
oral,under arm,rectal,forehead
Answer Link

Otras preguntas

How are elements organized on the periodic table? Select all that apply.
How is the falaj system in Oman and Yemen used? A. to provide education in rural schools B. to maintain ancient Islamic traditions C. to transport water to far
which type of sentence has two independent clauses joined by a comma and a conjunction
DNA tacaggtacccgaacccaattta
A Carpenter who is installing cabinets uses thin pieces of material called shims to fill gaps. the carpenter uses four shims to fill a gap that is 1.2 centimete
How would I do this ?
what is the name of the middle portion of the leaf?
A speed-time graph shows a car moving at 10 m/s for 10 s. The cars speed constantly decreases until it comes to a stop at 30 s. Which describes the slope of
Where had Dred Scott lived before returning to Missouri? Missouri and Maine California and Virginia Kansas and Nebraska Illinois and Wisconsin
The grocery store sells kumquats for $5.00 a pound and Asian pears for $3.25 a pound. Write an equation in standard form for the weights of kumquats k and Asian