aleenrose3632 aleenrose3632

23-03-2018
Biology

contestada

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Relax

Respuesta :

NAWty12345 NAWty12345

28-03-2018

A gene instructs for the making of protein molecules.
Please make brainliest!☺

Answer Link

Otras preguntas

Find the perimeter of the figure. ASAP PLEASE

You are working with Cristina to review some cases for your criminal justice class. The case you are working on now has one defendant: Mona Day. She is a studen

Help me please urgent

A container of an ideal gas at 1 atm is compressed to 1/3 its volume, with the temperature held constant, what is its final pressure?

In your opinion, do life appointments of Supreme Court judges positively or negatively affect the way the

Why is it important to do well in school based assessment activities

Solve for x and y can someone explain this to me? i’m not for sure how to solve it. will mark brainliest

If a ride at Disneyworld goes from rest to 27 m/s in 2.8 seconds and the mass of the ride and riders together is 5000 kg (true data!), what is the average power

how did tropical cyclone Eloise impact the environment

What would the height need to be for this curve to be a density curve? O 1/5 O 1/4 O 1/2 O 1