nateshawilliams55 nateshawilliams55

24-03-2022
Mathematics

contestada

calculate the value of 2a+3b if a=1 and b=2

Respuesta :

isalep93 isalep93

24-03-2022

calculate the value of 2a+3b if a=1 and b=2

= 2 * 1 + 3 * 2

= 2 + 6

= 8

* = multiply by

2a = 2 * a

and 3b = 3 * b

Answer Link

Otras preguntas

What is double of 0 (Sorry m just really slow right now)

HELP pleaseeeeeeeeeeeeeeeee

Please help me out :/

Need help u.s president a:john adams need help

What is the radius of this circle?

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Which formula can be used to find the nth term of the sequence 3, 21, 147, ... ?

The two major categories of transport are ___ and ___

PLSSS HELP IMEDEATLY Find the x- and y-intercepts of the graph of 2 – 6y = 35. State your answers as whole numbers or as improper fractions in simplest form.

eres hermosa, eres mi majer Amiga... (change the given sentence to English)