onaloubenedict
onaloubenedict onaloubenedict
  • 24-08-2021
  • Mathematics
contestada

Is 0.03456 a rational number​

Relax

Respuesta :

azbamulla02
azbamulla02 azbamulla02
  • 24-08-2021

Answer:

Yes. It is a rational number.

Answer Link

Otras preguntas

what is similarities and differences freedmen and serfs?
6 is 12% of what number
What number is 64% of 90
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha
one reason President Johnson created the Great Society program was to
what is 7/8ths of 40
Can anyone help? My teacher just briefly went over this in notes and I can't really decipher between physical and chemical changes in the examples