nashboolover nashboolover
  • 25-03-2021
  • English
contestada

what are some life changing decisions Romeo and Juliet made?

Relax

Respuesta :

cesarc1426
cesarc1426 cesarc1426
  • 25-03-2021

Answer:

Romeo and Juliet made a lot of life changing decision

Explanation:

The most notable answer is that they decided to end their lives, I would say that's a pretty impactful decision regarding their lives.

Answer Link

Otras preguntas

An ovule can be defined as:
1+4=52+5=123+6=218+11=?
how would living in Sparta or Athens be like
Tell whether the given value is a solution to the inequality. -2.4m>-6.8;m=-3
I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi
What molecule is responsible for determining the fate of each cell
2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A jewel case that holds 2 CDs is 140 mm x 120 mm x 9 mm. hat is the surface area of this jewel case?
Please explain how to find area of the rectangle pyramid.