freebrainliests freebrainliests

24-03-2021
Mathematics

contestada

What did Matt do wrong ??

(giving the person with the most understandable answer brainliest)

What did Matt do wrong giving the person with the most understandable answer brainliest class=

Respuesta :

desrahn20 desrahn20

24-03-2021

He did not distribute correctly in the first step.
4(x+2)=30
4x + 8=30
He should have distributed the 4 to the 2 as well.

Answer Link

Otras preguntas

PLS HURRY LESS THAN 5 MIN Which elements are least likely to be used by an author to develop an idea in a personal narrative? A. situation and conflict B. descr

Absolute governments (tho’ the disgrace of human nature) have this advantage with them, that they are simple; if the people suffer, they know the head from whic

In 2012, XYZ Inc., a medical equipment distributor, sold 10,000 units of its hospital beds at an average price of $500 per unit. The company reported estimated

Countries facing the economic conditions of the depression were more likely to see the rise of dictatorships. O True O False

A sales manager gathered information on the number of sales calls made and the number of copiers sold for a random sample of 20 sales representatives. From his

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Kennedy's speech implies that if people will fight for freedom and justice, their government will do the same. Which sentence best aligns with this idea? (3 poi

a body of mass 10 kg is moving with velocity of 10ms-1.a force acts for 5 seconds to reduce its velocity to 2ms-1.find the momentum of the body before and after

Which of the following best characterizes the french revolution brainly.

resistance to exploitation is a battle of wits with your captor