AlexKitten AlexKitten

23-01-2021
History

contestada

How could you explain the natives having English style buildings and English sounding words?

Respuesta :

malfaith11 malfaith11

23-01-2021

Answer:

english we can understand native was the first language

Explanation:

Answer Link

Otras preguntas

What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite

Explain why 2.15 and -2.15 are are opposites?

tips para perder el miedo a un sismo o terremoto y planes de evacuacion como el triangulo de la vida y kits de emergencia

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

find the quotient of 3870 and 18

Desert animals need to concentrate urine. What structural changes in the kidney would be associated with a kidney that is exceptionally good at concentrating ur

10(x+3)=9 mmmmmmmmmmmmmmmmm

6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist

2. How does Oliver violate the rules of the workhouse?

The answer to 5+5×5+5=