hdhgshwjidbbd hdhgshwjidbbd

23-12-2020
Chemistry

contestada

Epsom salt can be used to season foods. How would you write its chemical
formula?
A. Na2CI B.NaCI

Respuesta :

vichingmachine vichingmachine

23-12-2020

Answer:

B. NaCl

Explanation:

NaCl is sodium chloride, one form of it is epsom salt which we consume!

please give thanks, hit heart button! :)

Answer Link

Otras preguntas

the primary organic source of energy for living things are

What is double consciousness

Select all that apply. Select all the correct statements about ion sizes below. Check all that apply. Au3+ is smaller than Au+ As3− is smaller than P3−. Au+ is

The heart sounds S1 and S2 are...?

Dr potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

If 1+4=5 what is 8+11

what are examples of processing large data using web technologies

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri

If it takes 41.72 J to he a piece of gold waiting 18.69 g from 10.0°C to 27°C what is the specific heat of gold