iamlorniya
iamlorniya iamlorniya
  • 23-11-2020
  • Mathematics
contestada

what is the regular price of $4.19?

Respuesta :

heyyyyitsisabelle
heyyyyitsisabelle heyyyyitsisabelle
  • 23-11-2020

Answer: 4.00?

Step-by-step explanation:

Answer Link

Otras preguntas

Fill in the blank with the correct form of être in the imperfect. Ils_très agréables! A. étaient B. etes C. était D. été (Please pleaseee don’t take a guess jus
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
What us this cab someone help? 1 1-18 = 4​
Here is a list of ways of producing electricityA ) Wind farmsB ) Coal fired power stationsC ) hydroelectric power stationsD ) nuclear power stationsE ) gas fire
How did the Great Depression affect the Average American worker? A. more than one-fourth of the workforce was unemployed. B. competition for jobs increased due
What is the answer to this pls help
Isaiah started with 421 letters. At each stop he makes, he delivers 29 letters. How many letters are leftover?
help pleaseeeeeeeeeeeeeeeee
Can you get HIV from getting treatment at the dentist
Help ASAP with c....