maria7732 maria7732
  • 23-11-2020
  • Mathematics
contestada


Please help!!
(Question in the picture)

Please help Question in the picture class=
Relax

Respuesta :

rhysalterman
rhysalterman rhysalterman
  • 23-11-2020
Perpendicular,
Explanation:
I just drew it down on paper
Answer Link

Otras preguntas

The question is in attachment
what does hafa adai mean in guamanian
What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air and sulfur mainly from the soil
Dory and Nemo go to Taco Bell for lunch. Dory orders three soft tacos and three double deckers for $11.25. Nemo pays $10.00 for four soft tacos and two Double D
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
which of the following statements about taxes is FALSE? A-Taxes are collected a the local, state and federal level. B-Some states don't collect income tax. C-So
The tube that connects the bladder and the outside is called the
what is 7/8ths of 40
1. Explain the different forms of child abuse? Include Shaken Baby Syndrome in your response.
how many atoms are present in 4.0 mol of sodium