jhouston1107 jhouston1107

23-09-2020
History

contestada

Which age group accounted for the LOWEST total population in the year 2000?

Respuesta :

myathebest myathebest

23-09-2020

Answer:

65 years and over

Explanation:

People 65 years and over represented a smaller proportion of the total population in 2000 than in 1990.

Answer Link

arod105ar arod105ar

05-05-2022

Answer:Age 75-79

Explanation:

Answer Link

Otras preguntas

14. Find M Find AB= 3x+8

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

pls help i need answers fast will give brainliest

The label on a 3-pound bag of seeds states that it will cover an area of 288 square feet. What is the area that one pound of seeds will cover? First, reason dow

What is 639 ÷ 0.3 I neeed I help pls this is due Tomorrow help pls

Can someone pls do this on paper and show working

The cross-section of the prism below is a compound shape formed of two rectangles. Calculate the surface area of this prism. Give your answer in cm².

how's it going and good luck in your respective fields . Be strong and be courage's.

f the measure of angle 1 is 55 degrees then the measure of angle 3 is degrees.

After a prisoner initiates a petition for pardon in a superior court, A. the local district attorney gives an opinion to the judge. B. the local district attor