elenaclayton651 elenaclayton651

25-08-2020
Mathematics

contestada

What is the area of the composite figure?
4 in
O (877 + 6) in.2
(817 + 12) in 2
(877 + 18) in 2
(81T + 24) in 2
3 in

What is the area of the composite figure 4 in O 877 6 in2 817 12 in 2 877 18 in 2 81T 24 in 2 3 in class=

Relax

Respuesta :

nikkodiez19 nikkodiez19

25-08-2020

Answer:

8π + 12 in²

Step-by-step explanation:

Just add the areas of the semicircle and the triangle.

Answer Link

Otras preguntas

how many books could a printing press produce in five months? How many could a copyist produce in the same amount of time?

Zach took a science test. He answered 42 correct and 8 incorrect answers. What is the percentage of correct question?

Solve please ________________________________________________________________

3, How do paragraphs 4and 5 contribute to the development of ideas in the text? ) A. It describes the qualities a person needs to have to build their self- imag

Find a*b a = 4i + 8j b = -2i + 3j

given the equation: 3x^2 - 6x +10 = y write the left hand side in the form c(x+a)^2+b i'm confused as i dont know what is the left hand side thing

estion 1 The 10% Plan O a) increased the likelihood of a second civil war b) rejected the claims of slaves to property c) pushed for a rapid end to the Reconstr

what is the difference between minimal set test and minimum test set?in software QA

I’ll do your essay for you. Add me on g00g1e ch4t. My email is tomthrowaway2023 at g mail dotcom.

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I