opazjr0001 opazjr0001
  • 24-04-2020
  • Health
contestada

Identify the parts of the atom that are labeled in the diagram.

Relax

Respuesta :

Arbex
Arbex Arbex
  • 24-04-2020

Answer:Proton     Neutron        Electrons      Nucleus        

Lets se if that works .-.

Answer Link

Otras preguntas

write a sentence with the word labyrinth
A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut
In a recent year, certain colleges and universities received about $268 million in aid. Ten years later, they received about $94 million. Find the percent of ch
Nathan is buying a cell phone for his business. The regular price of the cell phone is $179. If he buys the phone in the next 2 weeks, he will get a 20% discoun
what does hafa adai mean in guamanian
find three acids and three bases used in your home. 1) what are theses acids and bases used for? 2)look up the chemical name and chemical formula of each acid a
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The role of media on reporting human rights violation
8 1/4 in simplest form
what is the most widely held ideal of the us political culture