madeleinecruz madeleinecruz
  • 23-04-2020
  • Mathematics
contestada

solve and round to the nearest hundredth 24.5 = - 2.5c - 4c

Relax

Respuesta :

tabitavega5500 tabitavega5500
  • 23-04-2020

Answer:

The answer is -3.76923076923 but to the nearest hundredth it is -3.77

Answer Link

Otras preguntas

Should anyone anywhere have the right to an education?
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
Which is the most abundant chemical found in living cells?
Which sentence contains a subordinating conjunction? We brought a casserole to the family with a new baby. I searched for my parents' faces in the crowd. Do you
if it 10 people take 4 days to dig a hole ,how long will take 8 men?​
Which describes the correlation shown in the scatterplot?
What is the weight of a 3000g girl who is swimming in the Pacific Ocean?
A rectangular pool in your friend’s yard is 150 ft. × 400 ft. Create a scale drawing with a scale factor of 1 600. Use a table or an equation to show how you co
Which question is a statistical question? How old is the class guinea pig? O How many calories are in a particular egg? How many jellybeans are in the classroom
How can I add ¾? Explain.