lowkey7hailey lowkey7hailey

21-04-2020
Mathematics

contestada

Which statement BEST describes this quadratic function?

A) increasing when x < 1
B) increasing when x > 1
C) increasing when x > 0
D) increasing when x < –1 and x > 3

Which statement BEST describes this quadratic function A increasing when x lt 1 B increasing when x gt 1 C increasing when x gt 0 D increasing when x lt 1 and class=

Relax

Respuesta :

lelianeal11 lelianeal11

21-04-2020

Answer:

B

Step-by-step explanation:

your only options are b and c but its not 0 so it has to be b

Answer Link

mmariscallonatm mmariscallonatm

21-04-2020

B) increasing when x >0

Answer Link

Otras preguntas

Please help this is due in an hour and I’m so confused

1. All American Boys is co-written by two authors from different racial and cultural backgrounds.How does the presence of two distinct voices influence the narr

What did Prometheus do that angered Zeus?

I need the answer to this questing

peace and order is the root of rule of law .justify this

I need help with mty math question please

One possible theme for "Professor Naismith's New Game" is "some inventions aren’t perfect at first". How do the events in the story demonstrate this theme? Use

HELP ME PLEASE!! Find the 6th term in the sequence

(Double Number Line)

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT