drr4 drr4
  • 21-10-2019
  • Mathematics
contestada

Seven times a number is the same as 12 more than 3 times the number

Respuesta :

harryxuanfu
harryxuanfu harryxuanfu
  • 21-10-2019

Answer:

x=3

Step-by-step explanation:

7x=12+3x

4x=12

x=3

Answer Link

Otras preguntas

What are 3 ways animals help the rainforest plants survive
can someone help me plz idk this
Why was Aristarchus’s model not accepted? Check all that apply
Find the value of x. The dot represents the center of the circle,​
i don’t understand!! help please!!
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
what is the adjective phrase in the sentence A group of insects includes butterflies.
Match the statements to the best answers Question 1 options: Glasnost Detente Afghanistan Ronald Reagan 1. Word used for the "easing" of tensions during the
Imagine a chromosome translocation event that brings a gene encoding a histone acetyl transferase enzyme from its original chromosomal location to a new one nea
Write in the blank whether the sentence is simple or compound. 1. Earth’s surface seems calm, but its interior seethes with energy. 2. Pressure and heat inside