kev2822 kev2822
  • 22-08-2019
  • Mathematics
contestada

12 more than a number

Relax

Respuesta :

dhks2347
dhks2347 dhks2347
  • 22-08-2019
12+ any variable (for example x)
Answer Link

Otras preguntas

i need help AZAP!!! How did advances in technology in the post-war era demonstrate the success of the free enterprise system?
What is the simplified form of 10,000x647 COE O 5000x32 O 5000x® O 100X O 100x32
True or False? A circle could be circumscribed about the quadrilateral below.
A regular hexagon is rotated 360° about its center. How many times does the image of the hexagon coincide with the prelmage during the rotation? O A 6 times ОВ.
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Write an equation for each graph below. ​
The 3p electrons in Si can shield the 3s electrons. True or false?
A teacher may be able to assist you in finding a tutor. Please select the best answer from the choices provided T F.
the lowest common multiple of 8 and 15 ​
Find the slope of each of the following lines.5. Two points on the line are (1,1) and (5,9)6. Two points on the line are (0,0) and (-3,6) help asap..