darselldione darselldione
  • 24-01-2019
  • Biology
contestada

Which human activity negatively affects the stability of the environment? A. Cutting down all trees in a forest B.Recycling paper C.Riding bicycles D.Planting trees

Relax

Respuesta :

o10172181 o10172181
  • 29-01-2019

Really? A. lol (no trees = unstable environment)

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
I need somebody's help..
what other fields of the study might contribute to knowledge and understanding in art history?
10(x+3)=9 mmmmmmmmmmmmmmmmm
Find the smallest zero for the function h(x) = 4x^2 - 8x - 60
Convert 2x - 3y + 1 = 0 to slope-intercept form
PLEASE HELP ME AASSAPP
how many atoms are present in 4.0 mol of sodium
“Just a matter of colouring...or lack of it. It is only a question of getting used to. Who is to say this colour is right and that is not?” Who is the speaker o
John Locke would have agreed with all of the following statements EXCEPT: