Aaliyahlouiserichard Aaliyahlouiserichard
  • 22-01-2024
  • Mathematics
contestada

A box of 56 chocolates contains milk, white and dark chocolates in the ratio 5:1:2. How many chocolates in the box are milk, white and dark?

Relax

Respuesta :

Otras preguntas

‼‼‼‼❗❗‼ HELP NEED RIGHT ANSWERS
Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands
What is the value of the expression 10 − (1/2)^4 ⋅ 48? 2 4 5 7
How do different authors use the same information to create opposing arguments?
How is the Voting Rights Act of 1965 related to the 15th Amendment?
Okay have posted the next question.
Help!!!!!! Thanks will make you brainily person
3 7/10 + 5 3/4 + 3/4
Answer this right and ill give u double points then what there is already
Most African Americans in the North couldn't attend public school. A: True B: False